SubtiBank SubtiBank
Version comparison:

2017-04-24 15:34:122025-05-25 17:55:59

description

low affinity potassium transporter KtrC-KtrD, peripheric membrane component

glutamate-controlled potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component

locus

BSU14510

BSU_14510

geneLength

663

666

product

low affinity potassium transporter KtrC-KtrD, peripheric membrane component (proton symport)

glutamate-controlled potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component

outlinks

bsu

BSU14510

BSU_14510

Gene

Coordinates

1,520,531 → 1,521,196

1,520,531 1,521,196

The protein

Paralogous protein(s)

[[protein|KtrA]]

[[this]]

The protein

[SW|Domains]

contains a [SW|RCK_N domain] at the N-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])

contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]

contains a [SW|RCK_N domain] at the N-terminus (aa 4-126)(according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])

contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (aa 135-219) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]

The protein

Effectors of protein activity

the protein binds c-di-AMP [Pubmed|23671116]

binds ADP and ATP [pubmed|30753894]

the protein binds c-di-AMP, KD = 30 nM, this results in inhibition of potassium uptake [Pubmed|30753894]

the affinity of [[protein|KtrC]]-[[protein|KtrD]] for potassium is strongly increased in the presence of glutamate [pubmed|32253343]

The protein

Structure

[PDB|4J7C] (the [[protein|KtrA]]-[[protein|KtrB]] complex, 56% identity) [Pubmed|23598340]

[PDB|4XTT] (the ''S. aureus'' KtrA [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]

[PDB|4J7C] (the [[protein|KtrA]]-[[protein|KtrB]] complex, 56% identity) [Pubmed|23598340]

[PDB|6I8V] ([[protein|KtrC]] in complex with ATP) [Pubmed|30753894]

[PDB|4XTT] (the ''S. aureus'' [[protein|KtrA]] [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]

Biological materials

Mutant

MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]

GHB6 ([[gene|ktrC]]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955

GP2264 ([[gene|ktrC]]::''ermC''), available in [SW|Jörg Stülke]'s lab

GP2079 ([[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab

GP2083 (D([[gene|ktrA]]-[[gene|ktrB]])::''aphA3'' D''[[gene|ktrC]]''::''tet''), available in [SW|Jörg Stülke]'s lab

MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]

GHB6 ([[gene|ktrC]]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955

GP2264 (''Δ''''[[gene|ktrC]]''::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2048 (''Δ''''[[gene|ktrC]]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2079 (''Δ''''[[gene|ktrC]]''::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2771 (''Δ''''[[gene|ktrC]]''::''spec''), available in [SW|Jörg Stülke]'s lab

GP2083 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3'' [[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

BKE14510 ([[gene|ktrC]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC

BKK14510 ([[gene|ktrC]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC

Biological materials

Expression vector

pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pGP2994: expression of Strep-KtrC in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP380]), available in [SW|Jörg Stülke]'s lab

pGP2995: expression of KtrC-Strep in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP382]), available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

References

Reviews

25869574, 27935846

25869574, 27935846, 25838295, 31361596, 32472931, 32603625

References

Original publications

12562800, 23671116, 23598340

12562800, 23671116, 23598340, 28420751, 28504641, 30753894, 31061098, 31506295, 32253343

The protein

Protein family

KtrA potassium transport family (with [[protein|KtrA]], according to UniProt)

The protein

Kinetic information

the [[protein|KtrC]]-[[protein|KtrD ]]channel has a low affinity for potassium, this is determined by [[protein|KtrD]] [pubmed|30753894]

the affinity of [[protein|KtrC]]-[[protein|KtrD]] for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) [pubmed|32253343]

Biological materials

Expression vectors

pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

labs

[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]

[SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]

[SW|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]

[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]